• Mutation; HGNC; 6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (from child cell line MM1.S).
  
• Mutation; HGNC; 12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (from child cell line MM1.S).
  

PubMed=2926241
Goldman-Leikin R.E., Salwen H.R., Herst C.V., Variakojis D., Bian M.-L., Le Beau M.M., Selvanayagan P., Marder R.J., Anderson R., Weitzman S., Rosen S.T.
Characterization of a novel myeloma cell line, MM.1.
J. Lab. Clin. Med. 113:335-345(1989)

PubMed=8943038; DOI=10.1073/pnas.93.24.13931; PMCID=PMC19472
Bergsagel P.L., Chesi M., Nardini E., Brents L.A., Kirby S.L., Kuehl W.M.
Promiscuous translocations into immunoglobulin heavy chain switch regions in multiple myeloma.
Proc. Natl. Acad. Sci. U.S.A. 93:13931-13936(1996)

PubMed=10087940; DOI=10.1016/S0165-4608(98)00157-5
Kuipers J., Vaandrager J.W., Weghuis D.O., Pearson P.L., Scheres J., Lokhorst H.M., Clevers H.C., Bast B.J.E.G.
Fluorescence in situ hybridization analysis shows the frequent occurrence of 14q32.3 rearrangements with involvement of immunoglobulin switch regions in myeloma cell lines.
Cancer Genet. Cytogenet. 109:99-107(1999)

DOI=10.1007/0-306-46877-8_4
Jernberg-Wiklund H., Nilsson K.
Multiple myeloma cell lines.
(In book chapter) Human cell culture. Vol. 3. Cancer cell lines part 3; Masters J.R.W., Palsson B.O. (eds.); pp.81-155; Kluwer Academic Publishers; New York; USA (2000)

PubMed=10936422; DOI=10.1016/S0145-2126(99)00195-2
Drexler H.G., Matsuo Y.
Malignant hematopoietic cell lines: in vitro models for the study of multiple myeloma and plasma cell leukemia.
Leuk. Res. 24:681-703(2000)

DOI=10.1016/B978-0-12-221970-2.50457-5
Drexler H.G.
The leukemia-lymphoma cell line factsbook.
(In book) ISBN 9780122219702; pp.1-733; Academic Press; London; United Kingdom (2001)

PubMed=12691914; DOI=10.1016/S0301-472X(03)00023-7
Greenstein S., Krett N.L., Kurosawa Y., Ma C.-G., Chauhan D., Hideshima T., Anderson K.C., Rosen S.T.
Characterization of the MM.1 human multiple myeloma (MM) cell lines: a model system to elucidate the characteristics, behavior, and signaling of steroid-sensitive and -resistant MM cells.
Exp. Hematol. 31:271-282(2003)

PubMed=28196595; DOI=10.1016/j.ccell.2017.01.005; PMCID=PMC5501076
Li J., Zhao W., Akbani R., Liu W.-B., Ju Z.-L., Ling S.-Y., Vellano C.P., Roebuck P., Yu Q.-H., Eterovic A.K., Byers L.A., Davies M.A., Deng W.-L., Gopal Y.N.V., Chen G., von Euw E.M., Slamon D.J., Conklin D., Heymach J.V., Gazdar A.F., Minna J.D., Myers J.N., Lu Y.-L., Mills G.B., Liang H.
Characterization of human cancer cell lines by reverse-phase protein arrays.
Cancer Cell 31:225-239(2017)