Cellosaurus logo
expasy logo

Cellosaurus MM.1 (CVCL_5801)

[Text version]
Cell line name MM.1
Synonyms MM-1; MM1
Accession CVCL_5801
Resource Identification Initiative To cite this cell line use: MM.1 (RRID:CVCL_5801)
Comments Part of: MD Anderson Cell Lines Project.
Population: African American.
Characteristics: Produces IgA lambda.
Doubling time: 72 hours (PubMed=12691914).
Omics: Proteomics; Expression; Reverse-phase protein array.
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Cell type: B-cell; CL=CL_0000236.
Sequence variations
  • Mutation; HGNC; HGNC:6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (from child cell line MM1.S).
  • Mutation; HGNC; HGNC:12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (from child cell line MM1.S).
Disease Plasma cell myeloma (NCIt: C3242)
Multiple myeloma (ORDO: Orphanet_29073)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Hierarchy Children:
CVCL_EI97 (MM.1-144)CVCL_8794 (MM1.R)CVCL_8793 (MM1.R(E))
CVCL_8792 (MM1.S)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
Web pages Info; MCLP; -; https://tcpaportal.org/mclp/
Publications

PubMed=2926241
Goldman-Leikin R.E., Salwen H.R., Herst C.V., Variakojis D., Bian M.-L., Le Beau M.M., Selvanayagan P., Marder R.J., Anderson R., Weitzman S.A., Rosen S.T.
Characterization of a novel myeloma cell line, MM.1.
J. Lab. Clin. Med. 113:335-345(1989)

PubMed=8943038; DOI=10.1073/pnas.93.24.13931; PMCID=PMC19472
Bergsagel P.L., Chesi M., Nardini E., Brents L.A., Kirby S.L., Kuehl W.M.
Promiscuous translocations into immunoglobulin heavy chain switch regions in multiple myeloma.
Proc. Natl. Acad. Sci. U.S.A. 93:13931-13936(1996)

PubMed=10087940; DOI=10.1016/S0165-4608(98)00157-5
Kuipers J., Vaandrager J.W., Weghuis D.O., Pearson P.L., Scheres J., Lokhorst H.M., Clevers H.C., Bast B.J.E.G.
Fluorescence in situ hybridization analysis shows the frequent occurrence of 14q32.3 rearrangements with involvement of immunoglobulin switch regions in myeloma cell lines.
Cancer Genet. Cytogenet. 109:99-107(1999)

DOI=10.1007/0-306-46877-8_4
Jernberg-Wiklund H., Nilsson K.
Multiple myeloma cell lines.
(In book chapter) Human cell culture. Vol. 3. Cancer cell lines part 3; Masters J.R.W., Palsson B.O. (eds.); pp.81-155; Kluwer Academic Publishers; New York; USA (2000)

PubMed=10936422; DOI=10.1016/S0145-2126(99)00195-2
Drexler H.G., Matsuo Y.
Malignant hematopoietic cell lines: in vitro models for the study of multiple myeloma and plasma cell leukemia.
Leuk. Res. 24:681-703(2000)

DOI=10.1016/B978-0-12-221970-2.50457-5
Drexler H.G.
The leukemia-lymphoma cell line factsbook.
(In book) ISBN 9780122219702; pp.1-733; Academic Press; London; United Kingdom (2001)

PubMed=12691914; DOI=10.1016/S0301-472X(03)00023-7
Greenstein S., Krett N.L., Kurosawa Y., Ma C.-G., Chauhan D., Hideshima T., Anderson K.C., Rosen S.T.
Characterization of the MM.1 human multiple myeloma (MM) cell lines: a model system to elucidate the characteristics, behavior, and signaling of steroid-sensitive and -resistant MM cells.
Exp. Hematol. 31:271-282(2003)

PubMed=28196595; DOI=10.1016/j.ccell.2017.01.005; PMCID=PMC5501076
Li J., Zhao W., Akbani R., Liu W.-B., Ju Z.-L., Ling S.-Y., Vellano C.P., Roebuck P., Yu Q.-H., Eterovic A.K., Byers L.A., Davies M.A., Deng W.-L., Gopal Y.N.V., Chen G., von Euw E.M., Slamon D.J., Conklin D., Heymach J.V., Gazdar A.F., Minna J.D., Myers J.N., Lu Y.-L., Mills G.B., Liang H.
Characterization of human cancer cell lines by reverse-phase protein arrays.
Cancer Cell 31:225-239(2017)

Cross-references
Cell line databases/resources cancercelllines; CVCL_5801
Cell_Model_Passport; SIDM00624
Anatomy/cell type resources BTO; BTO_0005490
Encyclopedic resources Wikidata; Q54906030
Experimental variables resources EFO; EFO_0001219
Polymorphism and mutation databases Cosmic; 2302411
Cosmic; 2367262
Entry history
Entry creation04-Apr-2012
Last entry update10-Apr-2025
Version number26