ID   MM.1
AC   CVCL_5801
SY   MM-1; MM1
DR   BTO; BTO:0005490
DR   EFO; EFO_0001219
DR   cancercelllines; CVCL_5801
DR   Cell_Model_Passport; SIDM00624
DR   Cosmic; 2302411
DR   Cosmic; 2367262
DR   Wikidata; Q54906030
RX   DOI=10.1007/0-306-46877-8_4;
RX   DOI=10.1016/B978-0-12-221970-2.50457-5;
RX   PubMed=2926241;
RX   PubMed=8943038;
RX   PubMed=10087940;
RX   PubMed=10936422;
RX   PubMed=12691914;
RX   PubMed=28196595;
WW   https://tcpaportal.org/mclp/
CC   Part of: MD Anderson Cell Lines Project.
CC   Population: African American.
CC   Characteristics: Produces IgA lambda.
CC   Doubling time: 72 hours (PubMed=12691914).
CC   Sequence variation: Mutation; HGNC; 6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (from child cell line MM1.S).
CC   Sequence variation: Mutation; HGNC; 12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (from child cell line MM1.S).
CC   Omics: Protein expression by reverse-phase protein arrays.
CC   Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
DI   NCIt; C3242; Plasma cell myeloma
DI   ORDO; Orphanet_29073; Multiple myeloma
OX   NCBI_TaxID=9606; ! Homo sapiens (Human)
SX   Female
AG   45Y
CA   Cancer cell line
DT   Created: 04-04-12; Last updated: 05-10-23; Version: 23
//
RX   DOI=10.1007/0-306-46877-8_4;
RA   Jernberg-Wiklund H., Nilsson K.;
RT   "Multiple myeloma cell lines.";
RL   (In) Human cell culture. Vol. 3. Cancer cell lines part 3; Masters J.R.W., Palsson B.O. (eds.); pp.81-155; Kluwer Academic Publishers; New York (2000).
//
RX   DOI=10.1016/B978-0-12-221970-2.50457-5;
RA   Drexler H.G.;
RT   "The leukemia-lymphoma cell line factsbook.";
RL   (In) ISBN 9780122219702; pp.1-733; Academic Press; London (2001).
//
RX   PubMed=2926241;
RA   Goldman-Leikin R.E., Salwen H.R., Herst C.V., Variakojis D.,
RA   Bian M.-L., Le Beau M.M., Selvanayagan P., Marder R.J., Anderson R.,
RA   Weitzman S., Rosen S.T.;
RT   "Characterization of a novel myeloma cell line, MM.1.";
RL   J. Lab. Clin. Med. 113:335-345(1989).
//
RX   PubMed=8943038; DOI=10.1073/pnas.93.24.13931;
RA   Bergsagel P.L., Chesi M., Nardini E., Brents L.A., Kirby S.L.,
RA   Kuehl W.M.;
RT   "Promiscuous translocations into immunoglobulin heavy chain switch
RT   regions in multiple myeloma.";
RL   Proc. Natl. Acad. Sci. U.S.A. 93:13931-13936(1996).
//
RX   PubMed=10087940; DOI=10.1016/S0165-4608(98)00157-5;
RA   Kuipers J., Vaandrager J.W., Weghuis D.O., Pearson P.L., Scheres J.,
RA   Lokhorst H.M., Clevers H.C., Bast B.J.E.G.;
RT   "Fluorescence in situ hybridization analysis shows the frequent
RT   occurrence of 14q32.3 rearrangements with involvement of
RT   immunoglobulin switch regions in myeloma cell lines.";
RL   Cancer Genet. Cytogenet. 109:99-107(1999).
//
RX   PubMed=10936422; DOI=10.1016/S0145-2126(99)00195-2;
RA   Drexler H.G., Matsuo Y.;
RT   "Malignant hematopoietic cell lines: in vitro models for the study of
RT   multiple myeloma and plasma cell leukemia.";
RL   Leuk. Res. 24:681-703(2000).
//
RX   PubMed=12691914; DOI=10.1016/S0301-472X(03)00023-7;
RA   Greenstein S., Krett N.L., Kurosawa Y., Ma C.-G., Chauhan D.,
RA   Hideshima T., Anderson K.C., Rosen S.T.;
RT   "Characterization of the MM.1 human multiple myeloma (MM) cell lines:
RT   a model system to elucidate the characteristics, behavior, and
RT   signaling of steroid-sensitive and -resistant MM cells.";
RL   Exp. Hematol. 31:271-282(2003).
//
RX   PubMed=28196595; DOI=10.1016/j.ccell.2017.01.005;
RA   Li J., Zhao W., Akbani R., Liu W.-B., Ju Z.-L., Ling S.-Y., Vellano C.P.,
RA   Roebuck P., Yu Q.-H., Eterovic A.K., Byers L.A., Davies M.A., Deng W.-L.,
RA   Gopal Y.N.V., Chen G., von Euw E.M., Slamon D.J., Conklin D.,
RA   Heymach J.V., Gazdar A.F., Minna J.D., Myers J.N., Lu Y.-L., Mills G.B.,
RA   Liang H.;
RT   "Characterization of human cancer cell lines by reverse-phase protein
RT   arrays.";
RL   Cancer Cell 31:225-239(2017).
//