Cellosaurus logo
expasy logo

Cellosaurus MM.1-144 (CVCL_EI97)

[Text version]
Cell line name MM.1-144
Synonyms MM.1.144; MM1-144
Accession CVCL_EI97
Resource Identification Initiative To cite this cell line use: MM.1-144 (RRID:CVCL_EI97)
Comments Population: African American.
Characteristics: Produces IgA lambda.
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Cell type: B-cell; CL=CL_0000236.
Sequence variations
  • Mutation; HGNC; HGNC:6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (PubMed=11157491).
  • Mutation; HGNC; HGNC:12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (from parent cell line).
Disease Plasma cell myeloma (NCIt: C3242)
Multiple myeloma (ORDO: Orphanet_29073)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Hierarchy Parent: CVCL_5801 (MM.1)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
Web pages Info; Keats Lab; -; https://www.keatslab.org/myeloma-cell-lines
Publications

PubMed=11157491; DOI=10.1182/blood.V97.3.729
Chesi M., Brents L.A., Ely S.A., Bais C., Robbiani D.F., Mesri E.A., Kuehl W.M., Bergsagel P.L.
Activated fibroblast growth factor receptor 3 is an oncogene that contributes to tumor progression in multiple myeloma.
Blood 97:729-736(2001)

Cross-references
Cell line databases/resources cancercelllines; CVCL_EI97
Encyclopedic resources Wikidata; Q54906031
Experimental variables resources EFO; EFO_0022356
Polymorphism and mutation databases Cosmic; 720780
Cosmic; 2391807
Entry history
Entry creation26-Sep-2016
Last entry update10-Apr-2025
Version number14