• Mutation; HGNC; 12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (PubMed=17692805).
  

PubMed=12691914; DOI=10.1016/S0301-472X(03)00023-7
Greenstein S., Krett N.L., Kurosawa Y., Ma C.-G., Chauhan D., Hideshima T., Anderson K.C., Rosen S.T.
Characterization of the MM.1 human multiple myeloma (MM) cell lines: a model system to elucidate the characteristics, behavior, and signaling of steroid-sensitive and -resistant MM cells.
Exp. Hematol. 31:271-282(2003)

PubMed=17692805; DOI=10.1016/j.ccr.2007.07.003
Keats J.J., Fonseca R., Chesi M., Schop R., Baker A., Chng W.-J., Van Wier S., Tiedemann R., Shi C.-X., Sebag M., Braggio E., Henry T., Zhu Y.-X., Fogle H., Price-Troska T.L., Ahmann G.J., Mancini C., Brents L.A., Kumar S.K., Greipp P., Dispenzieri A., Bryant B., Mulligan G., Bruhn L., Barrett M.T., Valdez R., Trent J.M., Stewart A.K., Carpten J.D., Bergsagel P.L.
Promiscuous mutations activate the noncanonical NF-kappaB pathway in multiple myeloma.
Cancer Cell 12:131-144(2007)

CLPUB00604
Chow S.
Targeted capture and sequencing of immunoglobulin rearrangements in multiple myeloma to enable detection of minimal residual disease.
Thesis MSc (2017), University of Toronto, Canada

PubMed=28196595; DOI=10.1016/j.ccell.2017.01.005
Li J., Zhao W., Akbani R., Liu W.-B., Ju Z.-L., Ling S.-Y., Vellano C.P., Roebuck P., Yu Q.-H., Eterovic A.K., Byers L.A., Davies M.A., Deng W.-L., Gopal Y.N.V., Chen G., von Euw E.M., Slamon D.J., Conklin D., Heymach J.V., Gazdar A.F., Minna J.D., Myers J.N., Lu Y.-L., Mills G.B., Liang H.
Characterization of human cancer cell lines by reverse-phase protein arrays.
Cancer Cell 31:225-239(2017)

PubMed=32123307; DOI=10.1038/s41375-020-0785-1
Sarin V., Yu K., Ferguson I.D., Gugliemini O., Nix M.A., Hann B., Sirota M., Wiita A.P.
Evaluating the efficacy of multiple myeloma cell lines as models for patient tumors via transcriptomic correlation analysis.
Leukemia 34:2754-2765(2020)