Cellosaurus logo
expasy logo
Due to maintenance work, this service will be unavailable from Mon Nov 11 17:30 until Tue Nov 12 09:00 CET. Apologies for the inconvenience.

Cellosaurus MM1.R(E) (CVCL_8793)

[Text version]
Cell line name MM1.R(E)
Synonyms MM1.RE
Accession CVCL_8793
Resource Identification Initiative To cite this cell line use: MM1.R(E) (RRID:CVCL_8793)
Comments Population: African American.
Characteristics: Produces IgA lambda (from parent cell line).
Characteristics: Resistant to dexamethasone.
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Cell type: B-cell; CL=CL_0000236.
Sequence variations
  • Mutation; HGNC; 6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (from parent cell line).
  • Mutation; HGNC; 12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (from parent cell line).
Disease Plasma cell myeloma (NCIt: C3242)
Multiple myeloma (ORDO: Orphanet_29073)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Hierarchy Parent: CVCL_5801 (MM.1)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
Publications

PubMed=12691914; DOI=10.1016/S0301-472X(03)00023-7
Greenstein S., Krett N.L., Kurosawa Y., Ma C.-G., Chauhan D., Hideshima T., Anderson K.C., Rosen S.T.
Characterization of the MM.1 human multiple myeloma (MM) cell lines: a model system to elucidate the characteristics, behavior, and signaling of steroid-sensitive and -resistant MM cells.
Exp. Hematol. 31:271-282(2003)

Cross-references
Cell line databases/resources cancercelllines; CVCL_8793
Encyclopedic resources Wikidata; Q54906037
Entry history
Entry creation06-Jun-2012
Last entry update05-Oct-2023
Version number16