• Mutation; HGNC; HGNC:11920; FAS; Simple; p.Leu229Tyrfs (c.686_705delTGAGTAAATATATCACCACT); Zygosity=Heterozygous (PubMed=10190897).
  
• Mutation; HGNC; HGNC:9065; PLCG1; Simple; p.Arg48Trp (c.142C>T); Zygosity=Heterozygous (CelloPub=CLPUB00592).
  
• Mutation; HGNC; HGNC:9065; PLCG1; Simple; p.Met750Val (c.2248A>G); Zygosity=Heterozygous (CelloPub=CLPUB00592).
  

PubMed=10190897; DOI=10.1084/jem.189.7.1063; PMCID=PMC2193006
Maeda T., Yamada Y., Moriuchi R., Sugahara K., Tsuruda K., Joh T., Atogami S., Tsukasaki K., Tomonaga M., Kamihira S.
Fas gene mutation in the progression of adult T cell leukemia.
J. Exp. Med. 189:1063-1071(1999)

PubMed=15638862; DOI=10.1111/j.1365-2141.2004.05289.x
Hasegawa H., Yamada Y., Harasawa H., Tsuji T., Murata K., Sugahara K., Tsuruda K., Ikeda S., Imaizumi Y., Tomonaga M., Masuda M., Takasu N., Kamihira S.
Sensitivity of adult T-cell leukaemia lymphoma cells to tumour necrosis factor-related apoptosis-inducing ligand.
Br. J. Haematol. 128:253-265(2005)

PubMed=19220422; DOI=10.1111/j.1600-0609.2009.01211.x
Kamihira S., Terada C., Sasaki D., Yanagihara K., Tsukasaki K., Hasegawa H., Yamada Y.
Aberrant p53 protein expression and function in a panel of hematopoietic cell lines with different p53 mutations.
Eur. J. Haematol. 82:301-307(2009)

PubMed=19710698; DOI=10.1038/leu.2009.171
Hasegawa H., Yamada Y., Iha H., Tsukasaki K., Nagai K., Atogami S., Sugahara K., Tsuruda K., Ishizaki A., Kamihira S.
Activation of p53 by Nutlin-3a, an antagonist of MDM2, induces apoptosis and cellular senescence in adult T-cell leukemia cells.
Leukemia 23:2090-2101(2009)

PubMed=27193821; DOI=10.1111/cas.12971; PMCID=PMC4982578
Hasegawa H., Bissonnette R.P., Gillings M., Sasaki D., Taniguchi H., Kitanosono H., Tsuruda K., Kosai K., Uno N., Morinaga Y., Imaizumi Y., Miyazaki Y., Yanagihara K.
Induction of apoptosis by HBI-8000 in adult T-cell leukemia/lymphoma is associated with activation of Bim and NLRP3.
Cancer Sci. 107:1124-1133(2016)

CLPUB00592
Patel V.M.
Functional interrogations of phospholipase c gamma 1 (PLCG1) mutations in Sezary syndrome.
Thesis PhD (2019); King's College London; London; United Kingdom