ID   KOB
AC   CVCL_VN49
DR   Cosmic; 2765562
DR   IARC_TP53; 26999
DR   Wikidata; Q95962168
RX   CelloPub=CLPUB00592;
RX   PubMed=10190897;
RX   PubMed=15638862;
RX   PubMed=19220422;
RX   PubMed=19710698;
RX   PubMed=27193821;
CC   Population: Japanese.
CC   Sequence variation: Mutation; HGNC; HGNC:11920; FAS; Simple; p.Leu229Tyrfs (c.686_705delTGAGTAAATATATCACCACT); Zygosity=Heterozygous (PubMed=10190897).
CC   Sequence variation: Mutation; HGNC; HGNC:9065; PLCG1; Simple; p.Arg48Trp (c.142C>T); Zygosity=Heterozygous (CelloPub=CLPUB00592).
CC   Sequence variation: Mutation; HGNC; HGNC:9065; PLCG1; Simple; p.Met750Val (c.2248A>G); Zygosity=Heterozygous (CelloPub=CLPUB00592).
CC   Transformant: NCBI_TaxID; 11908; Human T-lymphotropic virus 1 (HTLV-1).
CC   Derived from site: In situ; Ascites; UBERON=UBERON_0007795.
CC   Cell type: T-cell; CL=CL_0000084.
DI   NCIt; C3184; Adult T-cell leukemia/lymphoma
DI   ORDO; Orphanet_86875; Adult T-cell leukemia/lymphoma
OX   NCBI_TaxID=9606; ! Homo sapiens (Human)
SX   Male
AG   72Y
CA   Cancer cell line
DT   Created: 07-09-18; Last updated: 19-12-24; Version: 11
//
RX   CelloPub=CLPUB00592;
RA   Patel V.M.;
RT   "Functional interrogations of phospholipase c gamma 1 (PLCG1)
RT   mutations in Sezary syndrome.";
RL   Thesis PhD (2019); King's College London; London; United Kingdom.
//
RX   PubMed=10190897; DOI=10.1084/jem.189.7.1063; PMCID=PMC2193006;
RA   Maeda T., Yamada Y., Moriuchi R., Sugahara K., Tsuruda K., Joh T.,
RA   Atogami S., Tsukasaki K., Tomonaga M., Kamihira S.;
RT   "Fas gene mutation in the progression of adult T cell leukemia.";
RL   J. Exp. Med. 189:1063-1071(1999).
//
RX   PubMed=15638862; DOI=10.1111/j.1365-2141.2004.05289.x;
RA   Hasegawa H., Yamada Y., Harasawa H., Tsuji T., Murata K., Sugahara K.,
RA   Tsuruda K., Ikeda S., Imaizumi Y., Tomonaga M., Masuda M., Takasu N.,
RA   Kamihira S.;
RT   "Sensitivity of adult T-cell leukaemia lymphoma cells to tumour
RT   necrosis factor-related apoptosis-inducing ligand.";
RL   Br. J. Haematol. 128:253-265(2005).
//
RX   PubMed=19220422; DOI=10.1111/j.1600-0609.2009.01211.x;
RA   Kamihira S., Terada C., Sasaki D., Yanagihara K., Tsukasaki K.,
RA   Hasegawa H., Yamada Y.;
RT   "Aberrant p53 protein expression and function in a panel of
RT   hematopoietic cell lines with different p53 mutations.";
RL   Eur. J. Haematol. 82:301-307(2009).
//
RX   PubMed=19710698; DOI=10.1038/leu.2009.171;
RA   Hasegawa H., Yamada Y., Iha H., Tsukasaki K., Nagai K., Atogami S.,
RA   Sugahara K., Tsuruda K., Ishizaki A., Kamihira S.;
RT   "Activation of p53 by Nutlin-3a, an antagonist of MDM2, induces
RT   apoptosis and cellular senescence in adult T-cell leukemia cells.";
RL   Leukemia 23:2090-2101(2009).
//
RX   PubMed=27193821; DOI=10.1111/cas.12971; PMCID=PMC4982578;
RA   Hasegawa H., Bissonnette R.P., Gillings M., Sasaki D., Taniguchi H.,
RA   Kitanosono H., Tsuruda K., Kosai K., Uno N., Morinaga Y., Imaizumi Y.,
RA   Miyazaki Y., Yanagihara K.;
RT   "Induction of apoptosis by HBI-8000 in adult T-cell leukemia/lymphoma
RT   is associated with activation of Bim and NLRP3.";
RL   Cancer Sci. 107:1124-1133(2016).
//