Cellosaurus logo
expasy logo
Due to maintenance work, this service will be unavailable from Mon Nov 11 17:30 until Tue Nov 12 09:00 CET. Apologies for the inconvenience.

Cellosaurus MM.1S-luc (CVCL_B7F7)

[Text version]
Cell line name MM.1S-luc
Accession CVCL_B7F7
Resource Identification Initiative To cite this cell line use: MM.1S-luc (RRID:CVCL_B7F7)
Comments Population: African American.
Characteristics: Produces IgA lambda (from parent cell line).
Genetic integration: Method=Transfection/transduction; Gene=UniProtKB; P08659; Firefly luciferase (Note=With optimized codon usage for mammalian expression = effLuc).
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Cell type: B-cell; CL=CL_0000236.
Sequence variations
  • Mutation; HGNC; 6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (from parent cell line).
  • Mutation; HGNC; 12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (from parent cell line).
Disease Plasma cell myeloma (NCIt: C3242)
Multiple myeloma (ORDO: Orphanet_29073)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Hierarchy Parent: CVCL_8792 (MM1.S)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
Publications

PubMed=32123307; DOI=10.1038/s41375-020-0785-1; PMCID=PMC7483300
Sarin V., Yu K., Ferguson I.D., Gugliemini O., Nix M.A., Hann B., Sirota M., Wiita A.P.
Evaluating the efficacy of multiple myeloma cell lines as models for patient tumors via transcriptomic correlation analysis.
Leukemia 34:2754-2765(2020)

Cross-references
Cell line databases/resources cancercelllines; CVCL_B7F7
Encyclopedic resources Wikidata; Q112930119
Entry history
Entry creation23-Jun-2022
Last entry update10-Sep-2024
Version number6