ID   MM.1S-luc
AC   CVCL_B7F7
DR   cancercelllines; CVCL_B7F7
DR   Wikidata; Q112930119
RX   PubMed=32123307;
CC   Population: African American.
CC   Characteristics: Produces IgA lambda (from parent cell line).
CC   Sequence variation: Mutation; HGNC; 6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (from parent cell line).
CC   Sequence variation: Mutation; HGNC; 12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (from parent cell line).
CC   Transfected with: UniProtKB; P08659; Firefly luciferase (with optimized codon usage for mammalian expression = effLuc).
CC   Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
CC   Cell type: B-cell; CL=CL_0000236.
DI   NCIt; C3242; Plasma cell myeloma
DI   ORDO; Orphanet_29073; Multiple myeloma
OX   NCBI_TaxID=9606; ! Homo sapiens (Human)
HI   CVCL_8792 ! MM1.S
SX   Female
AG   45Y
CA   Cancer cell line
DT   Created: 23-06-22; Last updated: 05-10-23; Version: 5
//
RX   PubMed=32123307; DOI=10.1038/s41375-020-0785-1;
RA   Sarin V., Yu K., Ferguson I.D., Gugliemini O., Nix M.A., Hann B.,
RA   Sirota M., Wiita A.P.;
RT   "Evaluating the efficacy of multiple myeloma cell lines as models for
RT   patient tumors via transcriptomic correlation analysis.";
RL   Leukemia 34:2754-2765(2020).
//