Cellosaurus logo
expasy logo

Cellosaurus MDCi233-B (CVCL_B5J1)

[Text version]
Cell line name MDCi233-B
Accession CVCL_B5J1
Resource Identification Initiative To cite this cell line use: MDCi233-B (RRID:CVCL_B5J1)
Comments From: Max Delbruck Center Berlin Buch; Berlin; Germany.
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Sequence variations
  • Mutation; HGNC; HGNC:3097; DYSF; Simple; p.Leu369Pro (c.1106T>C); Zygosity=Heterozygous (hPSCreg=MDCi233-B).
  • Mutation; HGNC; HGNC:3097; DYSF; Simple; p.Arg1768_Pro1776del (c.5302_5328delCGGCCCCTCTACAGCCCCCTGCAGCCA); Zygosity=Heterozygous (hPSCreg=MDCi233-B).
Disease Limb-girdle muscular dystrophy type 2B (NCIt: C142080)
Dysferlin-related limb-girdle muscular dystrophy R2 (ORDO: Orphanet_268)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Originate from same individual CVCL_B5J0 ! MDCi233-A
Sex of cell Male
Age at sampling 30-34Y
Category Induced pluripotent stem cell
Cross-references
Cell line databases/resources hPSCreg; MDCi233-B
Biological sample resources BioSamples; SAMEA9422357
Encyclopedic resources Wikidata; Q110433025
Entry history
Entry creation16-Dec-2021
Last entry update19-Dec-2024
Version number5