Cellosaurus logo
expasy logo

Cellosaurus MDCi233-A (CVCL_B5J0)

[Text version]
Cell line name MDCi233-A
Accession CVCL_B5J0
Resource Identification Initiative To cite this cell line use: MDCi233-A (RRID:CVCL_B5J0)
Comments From: Max Delbruck Center Berlin Buch; Berlin; Germany.
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Sequence variations
  • Mutation; HGNC; HGNC:3097; DYSF; Simple; p.Leu369Pro (c.1106T>C); Zygosity=Heterozygous (hPSCreg=MDCi233-A).
  • Mutation; HGNC; HGNC:3097; DYSF; Simple; p.Arg1768_Pro1776del (c.5302_5328delCGGCCCCTCTACAGCCCCCTGCAGCCA); Zygosity=Heterozygous (hPSCreg=MDCi233-A).
Disease Limb-girdle muscular dystrophy type 2B (NCIt: C142080)
Dysferlin-related limb-girdle muscular dystrophy R2 (ORDO: Orphanet_268)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Originate from same individual CVCL_B5J1 ! MDCi233-B
Sex of cell Male
Age at sampling 30-34Y
Category Induced pluripotent stem cell
Cross-references
Cell line databases/resources hPSCreg; MDCi233-A
Biological sample resources BioSamples; SAMEA9422207
Encyclopedic resources Wikidata; Q110433024
Entry history
Entry creation16-Dec-2021
Last entry update19-Dec-2024
Version number5