Cellosaurus logo
expasy logo

Cellosaurus UCD115 (CVCL_ZV45)

[Text version]
Cell line name UCD115
Accession CVCL_ZV45
Resource Identification Initiative To cite this cell line use: UCD115 (RRID:CVCL_ZV45)
Comments Group: Triple negative breast cancer (TNBC) cell line.
Characteristics: Established from a patient-derived xenograft.
Doubling time: 65.4 hours, 67.7 hours (Note=With 17-beta-estradiol) (PubMed=32576280).
Omics: Transcriptome analysis by RNAseq.
Derived from site: In situ; Breast; UBERON=UBERON_0000310.
Sequence variations
  • Mutation; HGNC; HGNC:11998; TP53; Simple; p.Lys305fs*47 (c.892_911dupGAGCTGCCCCCAGGGAGCAC); Zygosity=Unspecified (PubMed=32576280).
Disease Invasive breast carcinoma of no special type (NCIt: C4194)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Female
Age at sampling 36Y
Category Cancer cell line
Publications

PubMed=32576280; DOI=10.1186/s13058-020-01300-y; PMCID=PMC7310532
Finlay-Schultz J., Jacobsen B.M., Riley D., Paul K.V., Turner S., Ferreira-Gonzalez A., Harrell J.C., Kabos P., Sartorius C.A.
New generation breast cancer cell lines developed from patient-derived xenografts.
Breast Cancer Res. 22:68.1-68.12(2020)

Cross-references
Encyclopedic resources Wikidata; Q98133835
Entry history
Entry creation02-Jul-2020
Last entry update19-Dec-2024
Version number6