Cellosaurus logo
expasy logo

Cellosaurus IRFMNi003-A-2 (CVCL_WZ55)

[Text version]
Cell line name IRFMNi003-A-2
Synonyms KO PKD2#36
Accession CVCL_WZ55
Resource Identification Initiative To cite this cell line use: IRFMNi003-A-2 (RRID:CVCL_WZ55)
Comments From: Istituto di Ricerche Farmacologiche Mario Negri (IRCCS); Bergamo; Italy.
Population: Caucasian.
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Sequence variations
  • Mutation; HGNC; HGNC:9009; PKD2; Simple_edited; p.Gln85Leufs*119 (c.254_279delAGGCGTGGAGCCGCGATAACCCCGGC); Zygosity=Heterozygous; Note=By CRISPR/Cas9 (PubMed=31830647).
  • Mutation; HGNC; HGNC:9009; PKD2; Simple_edited; p.Gly93Alafs*24 (c.276delC); Zygosity=Heterozygous; Note=By CRISPR/Cas9 (PubMed=31830647).
Disease Autosomal dominant polycystic kidney disease (NCIt: C84578)
Autosomal dominant polycystic kidney disease (ORDO: Orphanet_730)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Hierarchy Parent: CVCL_WU24 (IRFMNi003-A)
Sex of cell Female
Age at sampling 32Y
Category Induced pluripotent stem cell
Publications

PubMed=31830647; DOI=10.1016/j.scr.2019.101667
Trionfini P., Ciampi O., Romano E., Benigni A., Tomasoni S.
Generation of two isogenic knockout PKD2 iPS cell lines, IRFMNi003-A-1 and IRFMNi003-A-2, using CRISPR/Cas9 technology.
Stem Cell Res. 42:101667-101667(2020)

Cross-references
Cell line databases/resources hPSCreg; IRFMNi003-A-2
Biological sample resources BioSamples; SAMEA5781292
Encyclopedic resources Wikidata; Q94323830
Entry history
Entry creation06-Sep-2019
Last entry update19-Dec-2024
Version number9