Cellosaurus logo
expasy logo

Cellosaurus ESi047-A (CVCL_VD53)

[Text version]
Cell line name ESi047-A
Synonyms GLC-FiPS4F1
Accession CVCL_VD53
Resource Identification Initiative To cite this cell line use: ESi047-A (RRID:CVCL_VD53)
Comments Part of: Spanish Stem Cell Bank (Banco Nacional de Lineas Celulares) collection.
From: Centro de Medecina Regenerativa de Barcelona (CMRB); Barcelona; Spain.
Derived from site: In situ; Skin, dermis; UBERON=UBERON_0002067.
Cell type: Fibroblast of skin; CL=CL_0002620.
Sequence variations
  • Mutation; HGNC; HGNC:2597; CYP1B1; Simple; p.Lys468_Ser476dup (c.1403_1429dupAGAAAGTTCTTCGCCAATGCACCGCCT); dbSNP=rs72549373; Zygosity=Homozygous (PubMed=29453128).
Disease Primary congenital glaucoma 3A (NCIt: C148260)
Congenital glaucoma (ORDO: Orphanet_98976)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Male
Age at sampling 38Y
Category Induced pluripotent stem cell
Publications

PubMed=29453128; DOI=10.1016/j.scr.2018.01.004
Bolinches-Amoros A., Lukovic D., Artero Castro A., Leon M., Kamenarova K., Kaneva R., Jendelova P., Blanco-Kelly F., Ayuso C., Corton M., Erceg S.
Generation of a human iPSC line from a patient with congenital glaucoma caused by mutation in CYP1B1 gene.
Stem Cell Res. 28:96-99(2018)

Cross-references
Cell line databases/resources hPSCreg; ESi047-A
SKIP; SKIP003169
Encyclopedic resources Wikidata; Q54832805
Entry history
Entry creation14-May-2018
Last entry update19-Dec-2024
Version number13