• Mutation; HGNC; 11998; TP53; Simple; p.Ser313Glyfs*13 (c.937_968delAGCTCCTCTCCCCAGCCAAAGAAGAAACCACT); Zygosity=Unspecified (PubMed=8824565; PubMed=31378681).
  

PubMed=8824565; DOI=10.1002/(SICI)1097-0215(19960917)67:6<898::AID-IJC22>3.0.CO;2-X
Kang M.-S., Lee H.-J., Lee J.-H., Ku J.-L., Lee K.P., Kelley M.J., Won Y.-J., Kim S.-T., Park J.-G.
Mutation of p53 gene in hepatocellular carcinoma cell lines with HBX DNA.
Int. J. Cancer 67:898-902(1996)

PubMed=11819450; DOI=10.3748/wjg.v5.i4.289
Lee J.-H., Ku J.-L., Park Y.-J., Lee K.-U., Kim W.-H., Park J.-G.
Establishment and characterization of four human hepatocellular carcinoma cell lines containing hepatitis B virus DNA.
World J. Gastroenterol. 5:289-295(1999)

PubMed=19956504; DOI=10.4143/crt.2005.37.1.1
Ku J.-L., Park J.-G.
Biology of SNU cell lines.
Cancer Res. Treat. 37:1-19(2005)

PubMed=22460905; DOI=10.1038/nature11003
Barretina J.G., Caponigro G., Stransky N., Venkatesan K., Margolin A.A., Kim S., Wilson C.J., Lehar J., Kryukov G.V., Sonkin D., Reddy A., Liu M., Murray L., Berger M.F., Monahan J.E., Morais P., Meltzer J., Korejwa A., Jane-Valbuena J., Mapa F.A., Thibault J., Bric-Furlong E., Raman P., Shipway A., Engels I.H., Cheng J., Yu G.-Y.K., Yu J.-J., Aspesi P. Jr., de Silva M., Jagtap K., Jones M.D., Wang L., Hatton C., Palescandolo E., Gupta S., Mahan S., Sougnez C., Onofrio R.C., Liefeld T., MacConaill L.E., Winckler W., Reich M., Li N.-X., Mesirov J.P., Gabriel S.B., Getz G., Ardlie K., Chan V., Myer V.E., Weber B.L., Porter J., Warmuth M., Finan P., Harris J.L., Meyerson M.L., Golub T.R., Morrissey M.P., Sellers W.R., Schlegel R., Garraway L.A.
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.
Nature 483:603-607(2012)

PubMed=26589293; DOI=10.1186/s13073-015-0240-5
Scholtalbers J., Boegel S., Bukur T., Byl M., Goerges S., Sorn P., Loewer M., Sahin U., Castle J.C.
TCLP: an online cancer cell line catalogue integrating HLA type, predicted neo-epitopes, virus and gene expression.
Genome Med. 7:118.1-118.7(2015)

PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747
Dutil J., Chen Z.-H., Monteiro A.N.A., Teer J.K., Eschrich S.A.
An interactive resource to probe genetic diversity and estimated ancestry in cancer cell lines.
Cancer Res. 79:1263-1273(2019)

PubMed=31063779; DOI=10.1053/j.gastro.2019.05.001
Caruso S., Calatayud A.-L., Pilet J., La Bella T., Rekik S., Imbeaud S., Letouze E., Meunier L., Bayard Q., Rohr-Udilova N., Peneau C., Grasl-Kraupp B., de Koning L., Ouine B., Bioulac-Sage P., Couchy G., Calderaro J., Nault J.-C., Zucman-Rossi J., Rebouissou S.
Analysis of liver cancer cell lines identifies agents with likely efficacy against hepatocellular carcinoma and markers of response.
Gastroenterology 157:760-776(2019)

PubMed=31068700; DOI=10.1038/s41586-019-1186-3
Ghandi M., Huang F.W., Jane-Valbuena J., Kryukov G.V., Lo C.C., McDonald E.R. III, Barretina J.G., Gelfand E.T., Bielski C.M., Li H.-X., Hu K., Andreev-Drakhlin A.Y., Kim J., Hess J.M., Haas B.J., Aguet F., Weir B.A., Rothberg M.V., Paolella B.R., Lawrence M.S., Akbani R., Lu Y.-L., Tiv H.L., Gokhale P.C., de Weck A., Mansour A.A., Oh C., Shih J., Hadi K., Rosen Y., Bistline J., Venkatesan K., Reddy A., Sonkin D., Liu M., Lehar J., Korn J.M., Porter D.A., Jones M.D., Golji J., Caponigro G., Taylor J.E., Dunning C.M., Creech A.L., Warren A.C., McFarland J.M., Zamanighomi M., Kauffmann A., Stransky N., Imielinski M., Maruvka Y.E., Cherniack A.D., Tsherniak A., Vazquez F., Jaffe J.D., Lane A.A., Weinstock D.M., Johannessen C.M., Morrissey M.P., Stegmeier F., Schlegel R., Hahn W.C., Getz G., Mills G.B., Boehm J.S., Golub T.R., Garraway L.A., Sellers W.R.
Next-generation characterization of the Cancer Cell Line Encyclopedia.
Nature 569:503-508(2019)

PubMed=31378681; DOI=10.1016/j.ccell.2019.07.001
Qiu Z.-X., Li H., Zhang Z.-T., Zhu Z.-F., He S., Wang X.-J., Wang P.-C., Qin J.-J., Zhuang L.-P., Wang W., Xie F.-B., Gu Y., Zou K.-K., Li C., Li C., Wang C.-H., Cen J., Chen X.-T., Shu Y.-J., Zhang Z., Sun L.-L., Min L.-H., Fu Y., Huang X.-W., Lv H., Zhou H., Ji Y., Zhang Z.-G., Meng Z.-Q., Shi X.-L., Zhang H.-B., Li Y.-X., Hui L.-J.
A pharmacogenomic landscape in human liver cancers.
Cancer Cell 36:179-193.e11(2019)