• Mutation; HGNC; 11998; TP53; Simple; c.767_782+4delTGACCTGGAGTCTTCCAGTG; Zygosity=Unspecified (Cosmic-CLP=1479995; DepMap=ACH-000132).
  

PubMed=10695020
Yamada K., Tachibana T., Hashimoto H., Suzuki K., Yanagida S., Endoh H., Kimura E., Yasuda M., Tanaka T., Ishikawa H.
Establishment and characterization of cell lines derived from serous adenocarcinoma (JHOS-2) and clear cell adenocarcinoma (JHOC-5, JHOC-6) of human ovary.
Hum. Cell 12:131-138(1999)

PubMed=22460905; DOI=10.1038/nature11003; PMCID=PMC3320027
Barretina J.G., Caponigro G., Stransky N., Venkatesan K., Margolin A.A., Kim S., Wilson C.J., Lehar J., Kryukov G.V., Sonkin D., Reddy A., Liu M., Murray L., Berger M.F., Monahan J.E., Morais P., Meltzer J., Korejwa A., Jane-Valbuena J., Mapa F.A., Thibault J., Bric-Furlong E., Raman P., Shipway A., Engels I.H., Cheng J., Yu G.-Y.K., Yu J.-J., Aspesi P. Jr., de Silva M., Jagtap K., Jones M.D., Wang L., Hatton C., Palescandolo E., Gupta S., Mahan S., Sougnez C., Onofrio R.C., Liefeld T., MacConaill L.E., Winckler W., Reich M., Li N.-X., Mesirov J.P., Gabriel S.B., Getz G., Ardlie K., Chan V., Myer V.E., Weber B.L., Porter J., Warmuth M., Finan P., Harris J.L., Meyerson M.L., Golub T.R., Morrissey M.P., Sellers W.R., Schlegel R., Garraway L.A.
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.
Nature 483:603-607(2012)

PubMed=23839242; DOI=10.1038/ncomms3126; PMCID=PMC3715866
Domcke S., Sinha R., Levine D.A., Sander C., Schultz N.
Evaluating cell lines as tumour models by comparison of genomic profiles.
Nat. Commun. 4:2126.1-2126.10(2013)

PubMed=27397505; DOI=10.1016/j.cell.2016.06.017; PMCID=PMC4967469
Iorio F., Knijnenburg T.A., Vis D.J., Bignell G.R., Menden M.P., Schubert M., Aben N., Goncalves E., Barthorpe S., Lightfoot H., Cokelaer T., Greninger P., van Dyk E., Chang H., de Silva H., Heyn H., Deng X.-M., Egan R.K., Liu Q.-S., Mironenko T., Mitropoulos X., Richardson L., Wang J.-H., Zhang T.-H., Moran S., Sayols S., Soleimani M., Tamborero D., Lopez-Bigas N., Ross-Macdonald P., Esteller M., Gray N.S., Haber D.A., Stratton M.R., Benes C.H., Wessels L.F.A., Saez-Rodriguez J., McDermott U., Garnett M.J.
A landscape of pharmacogenomic interactions in cancer.
Cell 166:740-754(2016)

PubMed=27561551; DOI=10.1038/ncomms12645; PMCID=PMC5007461
Coscia F., Watters K.M., Curtis M., Eckert M.A., Chiang C.-Y., Tyanova S., Montag A., Lastra R.R., Lengyel E., Mann M.
Integrative proteomic profiling of ovarian cancer cell lines reveals precursor cell associated proteins and functional status.
Nat. Commun. 7:12645.1-12645.14(2016)

PubMed=30485824; DOI=10.1016/j.celrep.2018.10.096; PMCID=PMC6481945
Papp E., Hallberg D., Konecny G.E., Bruhm D.C., Adleff V., Noe M., Kagiampakis I., Palsgrove D., Conklin D., Kinose Y., White J.R., Press M.F., Drapkin R.I., Easwaran H., Baylin S.B., Slamon D.J., Velculescu V.E., Scharpf R.B.
Integrated genomic, epigenomic, and expression analyses of ovarian cancer cell lines.
Cell Rep. 25:2617-2633(2018)

PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747; PMCID=PMC6445675
Dutil J., Chen Z.-H., Monteiro A.N.A., Teer J.K., Eschrich S.A.
An interactive resource to probe genetic diversity and estimated ancestry in cancer cell lines.
Cancer Res. 79:1263-1273(2019)

PubMed=30971826; DOI=10.1038/s41586-019-1103-9
Behan F.M., Iorio F., Picco G., Goncalves E., Beaver C.M., Migliardi G., Santos R., Rao Y., Sassi F., Pinnelli M., Ansari R., Harper S., Jackson D.A., McRae R., Pooley R., Wilkinson P., van der Meer D.J., Dow D., Buser-Doepner C.A., Bertotti A., Trusolino L., Stronach E.A., Saez-Rodriguez J., Yusa K., Garnett M.J.
Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens.
Nature 568:511-516(2019)

PubMed=31068700; DOI=10.1038/s41586-019-1186-3; PMCID=PMC6697103
Ghandi M., Huang F.W., Jane-Valbuena J., Kryukov G.V., Lo C.C., McDonald E.R. 3rd, Barretina J.G., Gelfand E.T., Bielski C.M., Li H.-X., Hu K., Andreev-Drakhlin A.Y., Kim J., Hess J.M., Haas B.J., Aguet F., Weir B.A., Rothberg M.V., Paolella B.R., Lawrence M.S., Akbani R., Lu Y.-L., Tiv H.L., Gokhale P.C., de Weck A., Mansour A.A., Oh C., Shih J., Hadi K., Rosen Y., Bistline J., Venkatesan K., Reddy A., Sonkin D., Liu M., Lehar J., Korn J.M., Porter D.A., Jones M.D., Golji J., Caponigro G., Taylor J.E., Dunning C.M., Creech A.L., Warren A.C., McFarland J.M., Zamanighomi M., Kauffmann A., Stransky N., Imielinski M., Maruvka Y.E., Cherniack A.D., Tsherniak A., Vazquez F., Jaffe J.D., Lane A.A., Weinstock D.M., Johannessen C.M., Morrissey M.P., Stegmeier F., Schlegel R., Hahn W.C., Getz G., Mills G.B., Boehm J.S., Golub T.R., Garraway L.A., Sellers W.R.
Next-generation characterization of the Cancer Cell Line Encyclopedia.
Nature 569:503-508(2019)

PubMed=35839778; DOI=10.1016/j.ccell.2022.06.010; PMCID=PMC9387775
Goncalves E., Poulos R.C., Cai Z.-X., Barthorpe S., Manda S.S., Lucas N., Beck A., Bucio-Noble D., Dausmann M., Hall C., Hecker M., Koh J., Lightfoot H., Mahboob S., Mali I., Morris J., Richardson L., Seneviratne A.J., Shepherd R., Sykes E., Thomas F., Valentini S., Williams S.G., Wu Y.-X., Xavier D., MacKenzie K.L., Hains P.G., Tully B., Robinson P.J., Zhong Q., Garnett M.J., Reddel R.R.
Pan-cancer proteomic map of 949 human cell lines.
Cancer Cell 40:835-849.e8(2022)